Journal: bioRxiv

Article Title: Small leucine-rich proteoglycans inhibit CNS regeneration by modifying the structural and mechanical properties of the lesion environment

doi: 10.1101/2022.11.21.517128

Figure Lengend Snippet: A) Timeline of axonal regrowth and functional recovery after SCI in larval zebrafish. Timepoints of tissue collection for mass spectrometry (MS) analysis are indicated. B) Time course of axonal regrowth after spinal cord transection in elavl3 :GFP-F transgenic zebrafish. Shown is the same animal at different timepoints after SCI. Dashed lines indicate the dissected trunk region for MS analysis. Images shown are maximum intensity projections of the spinal lesion site (lateral view; rostral is left). Scale bars: 250 μm (top) and 25 μm (bottom). C-D) Heatmaps of matrisome proteins exhibiting differential abundance between lesioned (1 dpl, C; 2 dpl, D) and unlesioned age-matched groups. Each column represents one biological replicate and each row one protein. Asterisks indicate matrisome proteins that are common to both timepoints. A-D) dpl, days post-lesion; FC, fold change; FDR, false discovery rate; var, variant.

Article Snippet: To create the donor plasmid for elavl3 :GFP-F transgenic zebrafish, the sequence coding for the membrane-localized GFP (EGFP fused to farnesylation signal from c-HA-Ras) was amplified from the pEGFP-F vector (Clonetech) using primer pair #1, and cloned downstream of the zebrafish elavl3 promoter (Addgene plasmid Cat#59530) ( ).

Techniques: Functional Assay, Mass Spectrometry, Transgenic Assay, Variant Assay

Journal: bioRxiv

Article Title: Small leucine-rich proteoglycans inhibit CNS regeneration by modifying the structural and mechanical properties of the lesion environment

doi: 10.1101/2022.11.21.517128

Figure Lengend Snippet: A) pdgfrb + cell-specific induction of indicated slrp - mCherry fusions in pdgfrb :TetA; TetRE :SLRP-mCherry (short pdgfrb :SLRP) transgenic zebrafish leads to increased mCherry fluorescence (red) in the spinal lesion site at 1 dpl. Images shown are transversal views of the unlesioned trunk or lesion site (dorsal is up). B) pdgfrb + cell-specific induction of the SLRPs chad, fmoda, lum , and prelp but not aspn in pdgfrb :SLRP transgenic zebrafish reduces the thickness of the axonal bridge (B’; analyzed in elavl3 :GFP-F transgenics) and impairs recovery of swimming distance (B’’) at 2 dpl. Each data point represents one animal. Data are means ± SEM; * P < 0.05, ** P < 0.01, **** P < 0.0001. A-B) Scale bars: 20 μm. d, days; dpl, days post-lesion; DOX, doxycycline.

Article Snippet: To create the donor plasmid for elavl3 :GFP-F transgenic zebrafish, the sequence coding for the membrane-localized GFP (EGFP fused to farnesylation signal from c-HA-Ras) was amplified from the pEGFP-F vector (Clonetech) using primer pair #1, and cloned downstream of the zebrafish elavl3 promoter (Addgene plasmid Cat#59530) ( ).

Techniques: Transgenic Assay, Fluorescence

Journal: bioRxiv

Article Title: Small leucine-rich proteoglycans inhibit CNS regeneration by modifying the structural and mechanical properties of the lesion environment

doi: 10.1101/2022.11.21.517128

Figure Lengend Snippet: A) Timeline for experimental treatments shown in (B) and (C). B) Targeting Fmoda, Lum, or Prelp to the injury ECM in pdgfrb :SLRP transgenic zebrafish increases the co-polarization ratio (ratio of preserved polarization to total reflectivity) in the spinal lesion site, as determined by cross-polarized optical coherence tomography (CP-OCT) at 1 dpl. Images shown are average intensity projections of the lesion site (lateral view; rostral is left). C) Targeting Lum or Prelp to the injury ECM in pdgfrb :SLRP transgenic zebrafish decreases the mean Brillouin frequency shift ( ν B ) in the spinal lesion site, as determined by Brillouin microscopy (BM). Image shown is a sagittal optical section (overlay of brightfield intensity, confocal fluorescence, Brillouin frequency shift map) through the center of the lesion site of an elavl3 :GFP-F transgenic zebrafish at 1 dpl (lateral view; rostral is left). B-C) The dashed rectangle indicates the region of quantification. Each data point represents one animal. Box plots show the median, first and third quartile. Whiskers indicate the minimum and maximum values. ** P < 0.01, *** P < 0.001. Scale bars: 50 μm (B), 25 μm (C). d, days; dpl, days post-lesion; DOX, doxycycline; sc, spinal cord.

Article Snippet: To create the donor plasmid for elavl3 :GFP-F transgenic zebrafish, the sequence coding for the membrane-localized GFP (EGFP fused to farnesylation signal from c-HA-Ras) was amplified from the pEGFP-F vector (Clonetech) using primer pair #1, and cloned downstream of the zebrafish elavl3 promoter (Addgene plasmid Cat#59530) ( ).

Techniques: Transgenic Assay, Tomography, Microscopy, Fluorescence

Journal: bioRxiv

Article Title: Fis1 is required for the development of the dendritic mitochondrial network in pyramidal cortical neurons

doi: 10.1101/2025.01.07.631801

Figure Lengend Snippet: a ) Plot of normalized erGCaMP6-150 intensity in control (grey) or Fis1 386 shRNA (blue) neurons following glutamate uncaging. b ) Quantification of peak fluorescence decrease in control or Fis1 386 shRNA neurons showing slightly decreased, but not significant, ER calcium release in Fis1 KD neurons. c ) Plot of normalized erGCaMP6-150 intensity in control (grey) or Fis1 386 shRNA (blue) neurons following peak release. d ) Quantification of erGCaMP6-150 fluorescence recovery in control or Fis1 386 shRNA neurons showing decreased ER calcium re-uptake in Fis1 neurons. Control erGCaMP6-150 = 27 segments; Fis1 386 shRNA erGCaMP6-150 = 25 segments. p values are indicated in the figure following a Mann-Whitney test. Data are shown as individual points on box plots with 25 th , 50 th and 75 th percentiles indicated with whiskers indicating min and max values.

Article Snippet: pCAG:mtYFP-P2A-tdTomato, pCAG:tdTomato and pCAG:mt-YFP were previously published in [ ]. pCAG:2xmtpaGFP p2a 2xmtmScarlet was created by cloning a gene block encoding (from IDT) 2xmtpaGFP p2a 2xmtmScarlet into pCAG via restriction digest. pCAG:mt-SypHer was created by PCR of mt-SypHer from Addgene plasmid 48251 (a gift from Nicolas Demaurex) and cloning it 3’ to the CAG promoter. pCAG GCaMP6f was created by PCR of GCaMP6f from Addgene plasmid 40755 (a gift from Douglas Kim) and cloning it 3’ to the CAG promoter. pCAG mt-GCaMP6f was created by excising the YFP from pCAG mt-YFP and inserting GCaMP6f in its place. pCAG erGCaMP6-150 was created by PCR of GCaMP6-150 from Addgene plasmid 91777 (a gift from Douglas Kim) and cloning it 3’ to the CAG promoter while adding a KDEL retention motif to the C-terminus via the primers. pCAG HA-mouse Fis1 and pCAG HA-mouse Fis1 impervious were created by ordering gene blocks encoding a HA tag N-terminal to mouse Fis1 variant 1 or a mouse Fis1 variant 1 with the following sequences mutated (site 1 for Fis1 386 shRNA: cctggttcgaagcaaatacaa to tgccttgtgaggtctaagtacaa and site 2 for Fis1 C shRNA: ccaaggagctggaacgcctgattgataag to caaaggaacttgagcggctcatagataaa) and cloning them into the pCAG vector via restriction digest. pLKO.1 cloning vector was purchased from Addgene (plasmid 10878, a gift from David Root) and used as a control plasmid.

Techniques: Control, shRNA, Fluorescence, MANN-WHITNEY

Journal: eLife

Article Title: Aberrant hippocampal Ca2+ micro-waves following synapsin-dependent adeno-associated viral expression of Ca2+ indicators

doi: 10.7554/elife.93804

Figure Lengend Snippet: Figure 1. Development of Ca2+ microwaves travelling through hippocampus following GCaMP transduction. (a) Experimental protocol to examine CA1 neuronal activity using two-photon imaging following adeno-associated viral (AAV) transduction of genetically encoded Ca2+ indicators. (b) Immunohistochemical sections following the last imaging session. GCaMP6s (AAV1.syn.GCaMP6s.SV40, Addgene #100843) expression throughout the ipsilateral hippocampus and projection pathways in the contralateral hippocampus. (c) Two-photon Ca2+ imaging of field of view (FOV) in CA1 at 4 wk post-injection (p.i.) showing aberrant Ca2+ microwaves (see also Video 1). Magnified inset shows three coloured neuronal subgroups (blue, orange, magenta) based on their spatial vicinity from a total population of 100 identified neurons (green). Right: time series of two-photon Ca2+ imaging FOVs showing two Ca2+ microwaves, the first at 0 s, the second appearing at 6 s (asterisk). The second wave progresses through FOV over dozens of seconds. (d) Raster plot of individual neuronal Ca2+ activity (ΔF/F, 1 min moving window, traces max-normalized per neuron) from neighbouring subgroups (colours correspond to c). Asterisk (same as in c): a Ca2+ microwave advances through neighbouring neuronal subgroups. (e) Occurrence rate (mean ± 95% CI) of aberrant Ca2+ microwaves with increasing expression time, following viral transduction of AAV1.syn.GCaMP6s.SV40 in mature C57BL/6 wildtype animals (n=4). n.d. = none detected. (f) Two-photon Ca2+ imaging FOV in the visual cortex at 6 wk p.i. (left) with normal sparse spontaneous Ca2+ activity and no detected Ca2+ microwaves (right; raster plot of ΔF/F, 1 min moving window, traces max-normalized per neuron).

Article Snippet: GCaMP6s two- photon calcium imaging in the hippocampal CA1 region, around 100 μm beneath the hippocampal surface (stratum pyramidale), FOV ~600x600 μm, ~4 wk after transduction of AAV1 particles containing pAAV.Syn.GCaMP6s.WPRE.SV40 (Addgene plasmid #100843) in a mature bl6 wildtype mouse.

Techniques: Transduction, Activity Assay, Imaging, Immunohistochemical staining, Expressing, Injection

Journal: eLife

Article Title: Aberrant hippocampal Ca2+ micro-waves following synapsin-dependent adeno-associated viral expression of Ca2+ indicators

doi: 10.7554/elife.93804

Figure Lengend Snippet: Figure 2. Aberrant Ca2+ microwaves are consistent across laboratories and genetically encoded calcium indicator (GECI) variant. (a) Boxplot (median ± quartiles and range) of the occurrence rate of aberrant Ca2+ microwaves in CA1 at the different institutes at 6–8 wk after injection of GCaMP6s or GCaMP6m (number of animals in parenthesis). (b) Boxplots (median ± quartiles and range) of Ca2+ microwave diameters (left) and progression speed (right) in CA1 from each animal recorded across institutes. Inset: histogram of fluorescent intensity taken across each Ca2+-wave within an animal. Green line is the average, areas outside dashed lines mark 10% lowest fluorescence values, which were excluded from analysis. (c) Boxlot (median ± quartiles and range) of the occurrence rate of aberrant Ca2+ microwaves in CA1 following injection with commonly used GECIs (number of animals in parenthesis; see Table 1). (d) Two-photon Ca2+ imaging field of view (FOV) (left) in hippocampal CA1 following dual injection approach for conditional GCaMP6s expression (6 wk post-injection [p.i.]) with normal sparse spontaneous Ca2+ activity and no detection of Ca2+ microwaves (right; raster plot of ΔF/F, 1 min moving window, traces max-normalized per neuron).

Article Snippet: GCaMP6s two- photon calcium imaging in the hippocampal CA1 region, around 100 μm beneath the hippocampal surface (stratum pyramidale), FOV ~600x600 μm, ~4 wk after transduction of AAV1 particles containing pAAV.Syn.GCaMP6s.WPRE.SV40 (Addgene plasmid #100843) in a mature bl6 wildtype mouse.

Techniques: Variant Assay, Injection, Fluorescence, Imaging, Expressing, Activity Assay

Journal: Cell & Bioscience

Article Title: β-catenin mediates endodermal commitment of human ES cells via distinct transactivation functions

doi: 10.1186/s13578-024-01279-5

Figure Lengend Snippet: Generation of new CTNNB1-/- hESC clones and rescue of DE differentiation by ectopic expression of β-catenin. A Schematics of the donor and CRISPR/Cas9-based targeting strategy for insertional disruption of CTNNB1 gene via NHEJ mechanism. B Morphology and immunostaining of undifferentiated wt hESC (H1) and CTNNB1-/- clones (#3 and #7). Bright field images were shown with scale bar 100 μm. Immunostainings were performed using antibodies specific to β-catenin, pluripotency marker OCT4, NANOG, SOX2, and membrane protein E-cadherin, α-catenin and JUP. Scale bars = 50 μm in fluorescence images. C Western blot detection of β-catenin, JUP, E-cadherin, and β-catenin proteins in undifferentiated wt hESC (H1) and CTNNB1-/- clones (#3 and #7). D DE induction from wt hESC (H1) and CTNNB1-/- clones (#3 and #7). Shown are the workflow diagram for DE induction (upper) and results of DE differentiation (lower). Bright field images were taken at day 2 (d2) and day 4 (d4) post DE induction. Immunostaining for DE marker FOXA2 and SOX17 were performed at DE (d4). Nuclei were counterstained using Hoechst. Scale bars = 50 μm. E Lentivirus-delivered CTNNB1 expression in CTNNB1-/- clones. Shown are schematics of the Dox-inducible CTNNB1 cassette delivered by lentivirus (Lenti- CTNNB1 ) (upper) and qRT-PCR results from the transduced CTNNB1-/- clones (#3 and #7) (lower), which confirmed the Dox-induced expression of CTNNB1 transgene (CDS) and constant depletion of endogenous CTNNB1 mRNA (3’UTR). Data were normalized to wt hESC (H1) (red dashed line) and presented as mean ± SD. Student’s t-test was performed between Dox-induced and non-induced cells. *, p ≤ 0.05. F DE induction from Lenti- CTNNB1 transduced CTNNB1-/- clones (#3 and #7). Shown are the workflow diagram for Dox-based DE induction (upper) and results of DE differentiation in the absence (–) and presence (+) of Dox (lower). Bright-field images were taken at DE (d2) and immunostainings were performed for FOXA2 and SOX17 at DE (d4). Nuclei were counterstained using Hoechst (shown in small box). Scale bars = 50 μm

Article Snippet: The full-length coding sequences (CDS) of human CTNNB1 transcript variant 1 (NM_001904.3) (2346 bp) and CDH1 transcript variant 1 (NM_004360.5) (2649 bp) were amplified from H1 hESCs by RT-PCR and cloned into Fuw-tetO lentiviral vector carrying Dox-inducible CMV promoter (Addgene #20726) [ ].

Techniques: Clone Assay, Expressing, CRISPR, Disruption, Immunostaining, Marker, Membrane, Fluorescence, Western Blot, Quantitative RT-PCR

Journal: Cell & Bioscience

Article Title: β-catenin mediates endodermal commitment of human ES cells via distinct transactivation functions

doi: 10.1186/s13578-024-01279-5

Figure Lengend Snippet: Dose-dependent nuclear translocation and E-cadherin sequestration of ΔN 148 C mutant affect DE rescue outcomes. A Nuclear translocation of ΔN 148 and ΔN 148 C β-catenin mutants. Immunostaining of the ΔN 148 , ΔN 148 C and ΔC clones were performed after Dox treatment for 24 h (upper panels) and at DE (d1) (lower panels). Antibodies used were specific to β-catenin or Flag-tag. Two individual rescue clones were analyzed for each β-catenin mutant. The Dox-induced expression of CTNNB1 mutant transgenes were verified by qRT-PCR (middle panel) using primers binding to N-terminal (N-ter), central (ARM), and C-terminal (C-ter) regions in the CTNNB1 CDS. The data values were normalized to wt hESCs (H1) (dashed red lines). B Dose-dependent nuclear translocation of ΔN 148 C (left) and corresponding DE differentiation (right). Left panels showed the immunostaining of ΔN 148 C-F2 clone cells treated with Dox at different concentrations (indicated) for 24 h. Antibodies used were specific to E-cadherin (yellow) and Flag-tag (red). Shown were images with merged signals and close views of selected areas inside the dashed line boxes were shown below. Right panel showed the qRT-PCR analysis of DE-related genes ( FOXA2, SOX17, GATA4, GATA6 and EOMES ) at day 4 post DE induction, using Dox at different concentrations. The data values were normalized to that in wt hESCs (H1). For statistical analysis, all data were compared to that of non-induced cells. C E-cadherin expression in CDH1-/- hESCs derived from ΔN 148 C-F2 clone. Immunostaining of ΔN 148 C-F2 clone and ΔN 148 C-F2; CDH1-/- clones (#6 and #13) were performed. Antibody used were specific to E-cadherin (yellow). qRT-PCR and western blot quantified CDH1 mRNA and E-cadherin protein levels, respectively (lower panels). D Nuclear translation of ΔN 148 C in CDH1-/- hESC. Immunostaining of ΔN 148 C-F2 clone and ΔN 148 C-F2; CDH1-/- clones (#6 and #13) were performed after Dox treatment for 24 h (upper panels) and at DE (d1) (lower panels). Antibodies used were specific to Flag-tag (red). E Relative expression (fold) of FOXA2 and SOX17 at DE (d4) in ΔN 148 C-F2 clone and ΔN 148 C-F2; CDH1-/- clones (#6 and #13). For statistical analysis, data of ΔN 148 C-F2; CDH1-/- clones were compared to that of ΔN 148 C-F2 cells. F E-cadherin levels in CDH1- transduced ΔN 148 C-F2 clone. Immunostaining of ΔN 148 C-F2 and ΔN 148 C-F2; CDH1 OE cells were performed before and after Dox treatment for 6 h (upper panels). Antibodies used were specific to E-cadherin (yellow). qRT-PCR and western blot analysis showed CDH1 mRNA (lower left) and E-cadherin protein levels (lower right), respectively. G Nuclear translation (fold) of ΔN 148 C in CDH1 OE cells. Immunostaining of ΔN 148 C-F2 clone and ΔN 148 C-F2;C DH1 OE cells were performed after Dox treatment for 24 h (upper panels) and at DE (d1) (lower panels), using antibody specific to Flag-tag (red). Areas surrounded by the dashed white lines were enlarged below. H Relative expression (fold) of FOXA2 and SOX17 at DE (d4) in ΔN 148 C-F2 and the ΔN 148 C-F2;C DH1 OE cells. For statistical analysis, ΔN 148 C-F2;C DH1 OE clones’ data were compared to that of ΔN 148 C-F2 cells. Nuclei were counterstained using Hoechst (blue) in A , B , C , D , F and G . Scale bars = 50 μm in all images. The qRT-PCR data in A , B , C , E , F , and H were presented as mean ± SD (n = 3). Student’s t-test were performed for statistical analysis. ns, not significant; *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001

Article Snippet: The full-length coding sequences (CDS) of human CTNNB1 transcript variant 1 (NM_001904.3) (2346 bp) and CDH1 transcript variant 1 (NM_004360.5) (2649 bp) were amplified from H1 hESCs by RT-PCR and cloned into Fuw-tetO lentiviral vector carrying Dox-inducible CMV promoter (Addgene #20726) [ ].

Techniques: Translocation Assay, Mutagenesis, Immunostaining, Clone Assay, FLAG-tag, Expressing, Quantitative RT-PCR, Binding Assay, Derivative Assay, Western Blot